circad | circRNAs associated with diseases

Hsa_circ_0058124
Gene	FN1	Organism	Human
Genome Locus	chr2:216270960-216274462:-	Build	hg19
Disease	Papillary Thyroid Carcinoma	ICD-10	Malignant neoplasm of skin, unspecified (C44.9)
DBLink	Link to database	PMID	31324198
Experimental Method
Sample Type	Tissue and cell lines	Comparison	PTC and paired adjacent normal tissues were obtained from 92 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTTTGCAGTGAGCCATGGGA Reverse GAGTCGTCTCTCCTGTCACG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Yao, Y, Chen, X, Yang, H, Chen, W, Qian, Y, Yan, Z, Liao, T, Yao, W, Wu, W, Yu, T, Chen, Y, Zhang, Y (2019). Hsa_circ_0058124 promotes papillary thyroid cancer tumorigenesis and invasiveness through the NOTCH3/GATAD2A axis. J. Exp. Clin. Cancer Res., 38, 1:318.